Author: Olivier Sallou <osallou@debian.org>
        Matthias Klose <doko@debian.org>
Subject: disable network tests
Description: remove network related tests
 fixing bug 808593
Bug-Debian: https://bugs.debian.org/923539
Last-Updated: 2023-06-13
Forwarded: not-needed
--- a/src/test/java/htsjdk/samtools/seekablestream/SeekableBufferedStreamTest.java
+++ b/src/test/java/htsjdk/samtools/seekablestream/SeekableBufferedStreamTest.java
@@ -42,72 +42,6 @@
     private final String BAM_URL_STRING = "http://broadinstitute.github.io/picard/testdata/index_test.bam";
     private static File TestFile = new File("src/test/resources/htsjdk/samtools/seekablestream/megabyteZeros.dat");
 
-    /**
-     * Test reading across a buffer boundary (buffer size is 512000).   The test first reads a range of
-     * bytes using an unbuffered stream file stream,  then compares this to results from a buffered http stream.
-     *
-     * @throws IOException
-     */
-    @Test
-    public void testRandomRead() throws IOException {
-
-        int startPosition = 500000;
-        int length = 50000;
-
-        byte[] buffer1 = new byte[length];
-        SeekableStream unBufferedStream = new SeekableFileStream(BAM_FILE);
-        unBufferedStream.seek(startPosition);
-        int bytesRead = unBufferedStream.read(buffer1, 0, length);
-        assertEquals(length, bytesRead);
-
-        byte[] buffer2 = new byte[length];
-        SeekableStream bufferedStream = new SeekableBufferedStream(new SeekableHTTPStream(new URL(BAM_URL_STRING)));
-        bufferedStream.seek(startPosition);
-        bytesRead = bufferedStream.read(buffer2, 0, length);
-        assertEquals(length, bytesRead);
-
-        assertEquals(buffer1, buffer2);
-    }
-
-    @Test
-    public void testReadExactlyOneByteAtEndOfFile() throws IOException {
-        try (final SeekableStream stream = new SeekableHTTPStream(new URL(BAM_URL_STRING))){
-            byte[] buff = new byte[1];
-            long length = stream.length();
-            stream.seek(length - 1);
-            Assert.assertFalse(stream.eof());
-            Assert.assertEquals(stream.read(buff), 1);
-            Assert.assertTrue(stream.eof());
-            Assert.assertEquals(stream.read(buff), -1);
-        }
-    }
-
-
-    /**
-     * Test an attempt to read past the end of the file.  The test file is 594,149 bytes in length.  The test
-     * attempts to read a 1000 byte block starting at position 594000.  A correct result would return 149 bytes.
-     *
-     * @throws IOException
-     */
-    @Test
-    public void testEOF() throws IOException {
-
-        int remainder = 149;
-        long fileLength = BAM_FILE.length();
-        long startPosition = fileLength - remainder;
-        int length = 1000;
-
-
-        byte[] buffer = new byte[length];
-        SeekableStream bufferedStream = new SeekableBufferedStream(new SeekableHTTPStream(new URL(BAM_URL_STRING)));
-        bufferedStream.seek(startPosition);
-        int bytesRead = bufferedStream.read(buffer, 0, length);
-        assertEquals(remainder, bytesRead);
-
-        // Subsequent reads should return -1
-        bytesRead = bufferedStream.read(buffer, 0, length);
-        assertEquals(-1, bytesRead);
-    }
 
     @Test
     public void testSkip() throws IOException {
--- a/src/test/java/htsjdk/samtools/sra/SRAIndexTest.java
+++ b/src/test/java/htsjdk/samtools/sra/SRAIndexTest.java
@@ -50,85 +50,4 @@
     private static final int LAST_BIN_LEVEL = GenomicIndexUtil.LEVEL_STARTS.length - 1;
     private static final int SRA_BIN_OFFSET = GenomicIndexUtil.LEVEL_STARTS[LAST_BIN_LEVEL];
 
-    @Test
-    public void testLevelSize() {
-        final SRAIndex index = getIndex(DEFAULT_ACCESSION);
-        Assert.assertEquals(index.getLevelSize(0), GenomicIndexUtil.LEVEL_STARTS[1] - GenomicIndexUtil.LEVEL_STARTS[0]);
-
-        Assert.assertEquals(index.getLevelSize(LAST_BIN_LEVEL), GenomicIndexUtil.MAX_BINS - GenomicIndexUtil.LEVEL_STARTS[LAST_BIN_LEVEL] - 1);
-    }
-
-    @Test
-    public void testLevelForBin() {
-        final SRAIndex index = getIndex(DEFAULT_ACCESSION);
-        final Bin bin = new Bin(0, SRA_BIN_OFFSET);
-        Assert.assertEquals(index.getLevelForBin(bin), LAST_BIN_LEVEL);
-    }
-
-    @DataProvider(name = "testBinLocuses")
-    private Object[][] createDataForBinLocuses() {
-        return new Object[][] {
-                {DEFAULT_ACCESSION, 0, 0, 1, SRAIndex.SRA_BIN_SIZE},
-                {DEFAULT_ACCESSION, 0, 1, SRAIndex.SRA_BIN_SIZE + 1, SRAIndex.SRA_BIN_SIZE * 2}
-        };
-    }
-
-    @Test(dataProvider = "testBinLocuses")
-    public void testBinLocuses(SRAAccession acc, int reference, int binIndex, int firstLocus, int lastLocus) {
-        final SRAIndex index = getIndex(acc);
-        final Bin bin = new Bin(reference, SRA_BIN_OFFSET + binIndex);
-
-        Assert.assertEquals(index.getFirstLocusInBin(bin), firstLocus);
-        Assert.assertEquals(index.getLastLocusInBin(bin), lastLocus);
-    }
-
-    @DataProvider(name = "testBinOverlappings")
-    private Object[][] createDataForBinOverlappings() {
-        return new Object[][] {
-                {DEFAULT_ACCESSION, 0, 1, SRAIndex.SRA_BIN_SIZE, new HashSet<>(Arrays.asList(0))},
-                {DEFAULT_ACCESSION, 0, SRAIndex.SRA_BIN_SIZE + 1, SRAIndex.SRA_BIN_SIZE * 2, new HashSet<>(Arrays.asList(1))},
-                {DEFAULT_ACCESSION, 0, SRAIndex.SRA_BIN_SIZE + 1, SRAIndex.SRA_BIN_SIZE * 3, new HashSet<>(Arrays.asList(1, 2))},
-                {DEFAULT_ACCESSION, 0, SRAIndex.SRA_BIN_SIZE * 2, SRAIndex.SRA_BIN_SIZE * 2 + 1, new HashSet<>(Arrays.asList(1, 2))}
-        };
-    }
-
-
-    @Test(dataProvider = "testBinOverlappings")
-    public void testBinOverlappings(SRAAccession acc, int reference, int firstLocus, int lastLocus, Set<Integer> binNumbers) {
-        final SRAIndex index = getIndex(acc);
-        final Iterator<Bin> binIterator = index.getBinsOverlapping(reference, firstLocus, lastLocus).iterator();
-        final Set<Integer> binNumbersFromIndex = new HashSet<>();
-        while (binIterator.hasNext()) {
-            final Bin bin = binIterator.next();
-            binNumbersFromIndex.add(bin.getBinNumber() - SRA_BIN_OFFSET);
-        }
-
-        Assert.assertEquals(binNumbers, binNumbersFromIndex);
-    }
-
-    @DataProvider(name = "testSpanOverlappings")
-    private Object[][] createDataForSpanOverlappings() {
-        return new Object[][] {
-                {DEFAULT_ACCESSION, 0, 1, SRAIndex.SRA_BIN_SIZE, new long[] {0, SRAIndex.SRA_CHUNK_SIZE} },
-                {DEFAULT_ACCESSION, 0, SRAIndex.SRA_BIN_SIZE * 2, SRAIndex.SRA_BIN_SIZE * 2 + 1, new long[]{0, SRAIndex.SRA_CHUNK_SIZE} },
-                {DEFAULT_ACCESSION, 0, SRAIndex.SRA_CHUNK_SIZE, SRAIndex.SRA_CHUNK_SIZE + 1, new long[]{0, SRAIndex.SRA_CHUNK_SIZE, SRAIndex.SRA_CHUNK_SIZE, SRAIndex.SRA_CHUNK_SIZE * 2} },
-        };
-    }
-
-    @Test(dataProvider = "testSpanOverlappings")
-    public void testSpanOverlappings(SRAAccession acc, int reference, int firstLocus, int lastLocus, long[] spanCoordinates) {
-        final SRAIndex index = getIndex(acc);
-        final BAMFileSpan span = index.getSpanOverlapping(reference, firstLocus, lastLocus);
-
-        long[] coordinatesFromIndex = span.toCoordinateArray();
-
-        Assert.assertTrue(Arrays.equals(coordinatesFromIndex, spanCoordinates),
-                "Coordinates mismatch. Expected: " + Arrays.toString(spanCoordinates) +
-                " but was : " + Arrays.toString(coordinatesFromIndex));
-    }
-
-    private SRAIndex getIndex(SRAAccession acc) {
-        final SRAFileReader reader = new SRAFileReader(acc);
-        return (SRAIndex) reader.getIndex();
-    }
 }
--- a/src/test/java/htsjdk/samtools/sra/SRATest.java
+++ b/src/test/java/htsjdk/samtools/sra/SRATest.java
@@ -56,378 +56,5 @@
  */
 public class SRATest extends AbstractSRATest {
 
-    @DataProvider(name = "testCounts")
-    private Object[][] createDataForCounts() {
-        return new Object[][] {
-            {"SRR2096940", 10591, 498},
-            {"SRR000123", 0, 4583}
-        };
-    }
-
-    @Test(dataProvider = "testCounts")
-    public void testCounts(String acc, int expectedNumMapped, int expectedNumUnmapped) {
-        SamReader reader = SamReaderFactory.make().validationStringency(ValidationStringency.SILENT).open(
-                SamInputResource.of(new SRAAccession(acc))
-        );
-
-        final SAMRecordIterator samRecordIterator = reader.iterator();
-
-        assertCorrectCountsOfMappedAndUnmappedRecords(samRecordIterator, expectedNumMapped, expectedNumUnmapped);
-    }
-
-    @DataProvider(name = "testCountsBySpan")
-    private Object[][] createDataForCountsBySpan() {
-        return new Object[][] {
-            {"SRR2096940", Arrays.asList(new Chunk(0, 59128983), new Chunk(59128983, 59141089)), 10591, 498},
-            {"SRR2096940", Arrays.asList(new Chunk(0, 29128983), new Chunk(29128983, 59141089)), 10591, 498},
-            {"SRR2096940", Arrays.asList(new Chunk(0, 59134983), new Chunk(59134983, 59141089)), 10591, 498},
-            {"SRR2096940", Arrays.asList(new Chunk(0, 59130000)),                                10591, 0},
-            {"SRR2096940", Arrays.asList(new Chunk(0, 59140889)),                                10591, 298}
-        };
-    }
-
-    @Test(dataProvider = "testCountsBySpan")
-    public void testCountsBySpan(String acc, List<Chunk> chunks, int expectedNumMapped, int expectedNumUnmapped) {
-        SamReader reader = SamReaderFactory.make().validationStringency(ValidationStringency.SILENT).open(
-                SamInputResource.of(new SRAAccession(acc))
-        );
-
-        final SAMRecordIterator samRecordIterator = ((SamReader.Indexing) reader).iterator(new BAMFileSpan(chunks));
-
-        assertCorrectCountsOfMappedAndUnmappedRecords(samRecordIterator, expectedNumMapped, expectedNumUnmapped);
-    }
-
-    @DataProvider(name = "testGroups")
-    private Object[][] createDataForGroups() {
-        return new Object[][] {
-            {"SRR1035115", new TreeSet<>(Arrays.asList("15656144_B09YG", "15656144_B09MR"))},
-            {"SRR2096940", new TreeSet<>(Arrays.asList("SRR2096940"))}
-        };
-    }
-
-    @Test(dataProvider = "testGroups")
-    public void testGroups(String acc, Set<String> groups) {
-        SamReader reader = SamReaderFactory.make().validationStringency(ValidationStringency.SILENT).open(
-                SamInputResource.of(new SRAAccession(acc))
-        );
-
-        final SAMRecordIterator samRecordIterator = reader.iterator();
-
-        SAMFileHeader header = reader.getFileHeader();
-        Set<String> headerGroups = new TreeSet<>();
-        for (SAMReadGroupRecord group : header.getReadGroups()) {
-            Assert.assertEquals(group.getReadGroupId(), group.getId());
-            headerGroups.add(group.getReadGroupId());
-        }
-
-        Assert.assertEquals(groups, headerGroups);
-
-        Set<String> foundGroups = new TreeSet<>();
-
-        for (int i = 0; i < 10000; i++) {
-            if (!samRecordIterator.hasNext()) {
-                break;
-            }
-            SAMRecord record = samRecordIterator.next();
-            String groupName = (String)record.getAttribute("RG");
-
-            foundGroups.add(groupName);
-        }
-
-        // please note that some groups may be introduced after 10k records, which is not an error
-        Assert.assertEquals(groups, foundGroups);
-    }
-
-    @DataProvider(name = "testReferences")
-    private Object[][] createDataForReferences() {
-        return new Object[][] {
-            // primary alignment only
-            {"SRR353866", 9,
-                    Arrays.asList(
-                            "AAAB01001871.1", "AAAB01002233.1", "AAAB01004056.1", "AAAB01006027.1",
-                            "AAAB01008846.1", "AAAB01008859.1", "AAAB01008960.1", "AAAB01008982.1",
-                            "AAAB01008987.1"
-                    ),
-                    Arrays.asList(
-                            1115, 1034, 1301, 1007,
-                            11308833, 12516315, 23099915, 1015562,
-                            16222597
-                    )},
-        };
-    }
-
-    @Test(dataProvider = "testReferences")
-    public void testReferences(String acc, int numberFirstReferenceFound, List<String> references, List<Integer> refLengths) {
-        SamReader reader = SamReaderFactory.make().validationStringency(ValidationStringency.SILENT).open(
-                SamInputResource.of(new SRAAccession(acc))
-        );
-
-        final SAMRecordIterator samRecordIterator = reader.iterator();
-
-        SAMFileHeader header = reader.getFileHeader();
-        Set<String> headerRefNames = new TreeSet<>();
-
-        for (SAMSequenceRecord ref : header.getSequenceDictionary().getSequences()) {
-            String refName = ref.getSequenceName();
-
-            int refIndex = references.indexOf(refName);
-            Assert.assertTrue(refIndex != -1, "Unexpected reference: " + refName);
-
-            Assert.assertEquals(refLengths.get(refIndex), (Integer) ref.getSequenceLength(), "Reference length is incorrect");
-
-            headerRefNames.add(refName);
-        }
-
-        Assert.assertEquals(new TreeSet<>(references), headerRefNames);
-
-        Set<String> foundRefNames = new TreeSet<>();
-        for (int i = 0; i < 10000; i++) {
-            if (!samRecordIterator.hasNext()) {
-                break;
-            }
-            SAMRecord record = samRecordIterator.next();
-
-            if (record.getReferenceIndex().equals(SAMRecord.NO_ALIGNMENT_REFERENCE_INDEX)) {
-                continue;
-            }
-
-            String refName = record.getReferenceName();
-            Assert.assertNotNull(refName);
-
-            foundRefNames.add(refName);
-        }
-
-        Assert.assertEquals(new TreeSet<>(references.subList(0, numberFirstReferenceFound)), foundRefNames);
-    }
-
-    @DataProvider(name = "testRows")
-    private Object[][] createDataForRowsTest() {
-        return new Object[][] {
-            // primary alignment only
-            {"SRR2127895", 1, 83, "SRR2127895.R.1",
-                    "CGTGCGCGTGACCCATCAGATGCTGTTCAATCAGTGGCAAATGCGGAACGGTTTCTGCGGGTTGCCGATATTCTGGAGAGTAATGCCAGGCAGGGGCAGGT",
-                    "DDBDDDDDBCABC@CCDDDC?99CCA:CDCDDDDDDDECDDDFFFHHHEGIJIIGIJIHIGJIJJJJJJJIIJIIHIGJIJJJIJJIHFFBHHFFFDFBBB",
-                    366, "29S72M", "gi|152968582|ref|NC_009648.1|", 147, true, false, false},
-
-            // small SRA archive
-            {"SRR2096940", 1, 16, "SRR2096940.R.3",
-                    "GTGTGTCACCAGATAAGGAATCTGCCTAACAGGAGGTGTGGGTTAGACCCAATATCAGGAGACCAGGAAGGAGGAGGCCTAAGGATGGGGCTTTTCTGTCACCAATCCTGTCCCTAGTGGCCCCACTGTGGGGTGGAGGGGACAGATAAAAGTACCCAGAACCAGAG",
-                    "AAAABFFFFFFFGGGGGGGGIIIIIIIIIIIIIIIIIIIIIIIIIIIIII7IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIGGGGGFGFFDFFFFFC",
-                    55627016, "167M", "CM000681.1", 42, false, false, false},
-
-            {"SRR2096940", 10591, 4, "SRR2096940.R.10592",
-                    "CTCTGGTTCTGGGTACTTTTATCTGTCCCCTCCACCCCACAGTGGCGAGCCAGATTCCTTATCTGGTGACACAC",
-                    "IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII",
-                    -1, null, null, -1, false, false, false},
-
-            // primary and secondary alignments
-            {"SRR833251", 81, 393, "SRR833251.R.51",
-                    "ATGCAAATCCGAATGGGCTATTTGTGGGTACTTGGGCAGGTAAGTAGCTGGCAATCTTGGTCGGTAAACCAATACCCAAGTTCACATAGGCACCATCGGGA",
-                    "CCCFFFFFHHHHHIJJJIJJJJJIIJJJGIJIJIIJIJJJDGIGIIJIJIHIJJJJJJGIGHIHEDFFFFDDEEEDDDDDCDEEDDDDDDDDDDDDDBBDB",
-                    1787186, "38M63S", "gi|169794206|ref|NC_010410.1|", 11, true, true, true},
-
-            // local SRA file
-            {"src/test/resources/htsjdk/samtools/sra/test_archive.sra", 1, 99, "test_archive.R.2",
-                    "TGTCGATGCTGAAAGTGTCTGCGGTGAACCACTTCATGCACAGCGCACACTGCAGCTCCACTTCACCCAGCTGACGGCCGTTCTCATCGTCTCCAGAGCCCGTCTGAGCGTCCGCTGCTTCAGAACTGTCCCCGGCTGTATCCTGAAGAC",
-                    "BBAABBBFAFFFGGGGGGGGGGGGEEFHHHHGHHHHHFHHGHFDGGGGGHHGHHHHHHHHHHHHFHHHGHHHHHHGGGGGGGHGGHHHHHHHHHGHHHHHGGGGHGHHHGGGGGGGGGHHHHEHHHHHHHHHHGCGGGHHHHHHGBFFGF",
-                    2811570, "150M", "NC_007121.5", 60, true, false, false}
-        };
-    }
-
-    @Test(dataProvider = "testRows")
-    public void testRows(String acc, int recordIndex, int flags, String readName, String bases, String quals, int refStart, String cigar,
-                         String refName, int mapQ, boolean hasMate, boolean isSecondOfPair, boolean isSecondaryAlignment) {
-        SAMRecord record = getRecordByIndex(acc, recordIndex, false);
-
-        checkSAMRecord(record, flags, readName, bases, quals, refStart, cigar, refName, mapQ, hasMate, isSecondOfPair, isSecondaryAlignment);
-    }
-
-    @Test(dataProvider = "testRows")
-    public void testRowsAfterIteratorDetach(String acc, int recordIndex, int flags, String readName, String bases, String quals,
-                                            int refStart, String cigar, String refName, int mapQ, boolean hasMate,
-                                            boolean isSecondOfPair, boolean isSecondaryAlignment) {
-        SAMRecord record = getRecordByIndex(acc, recordIndex, true);
-
-        checkSAMRecord(record, flags, readName, bases, quals, refStart, cigar, refName, mapQ, hasMate, isSecondOfPair, isSecondaryAlignment);
-    }
-
-    @Test(dataProvider = "testRows")
-    public void testRowsOverrideValues(String acc, int recordIndex, int flags, String readName, String bases, String quals,
-                                       int refStart, String cigar, String refName, int mapQ, boolean hasMate,
-                                       boolean isSecondOfPair, boolean isSecondaryAlignment) {
-        SAMRecord record = getRecordByIndex(acc, recordIndex, true);
-        SAMFileHeader header = record.getHeader();
-
-        record.setFlags(0);
-        record.setReadUnmappedFlag(refStart == -1);
-        record.setReadBases("C".getBytes());
-        record.setBaseQualities(SAMUtils.fastqToPhred("A"));
-        if (refStart == -1) {
-            checkSAMRecord(record, 4, readName, "C", "A", refStart, "1M", refName, mapQ, false, false, false);
-        } else {
-            int sequenceIndex = header.getSequenceIndex(refName);
-            Assert.assertFalse(sequenceIndex == -1);
-
-            if (sequenceIndex == 0) {
-                if (header.getSequenceDictionary().getSequences().size() > 1) {
-                    sequenceIndex++;
-                }
-            } else {
-                sequenceIndex--;
-            }
-
-            refName = header.getSequence(sequenceIndex).getSequenceName();
-
-            record.setAlignmentStart(refStart - 100);
-            record.setCigarString("1M");
-            record.setMappingQuality(mapQ - 1);
-            record.setReferenceIndex(sequenceIndex);
-
-            checkSAMRecord(record, 0, readName, "C", "A", refStart - 100, "1M", refName, mapQ - 1, false, false, false);
-        }
-    }
-
-    @Test(dataProvider = "testRows")
-    public void testRowsBySpan(String acc, int recordIndex, int flags, String readName, String bases, String quals,
-                                            int refStart, String cigar, String refName, int mapQ, boolean hasMate,
-                                            boolean isSecondOfPair, boolean isSecondaryAlignment) {
-        SamReader reader = SamReaderFactory.make().validationStringency(ValidationStringency.SILENT).open(
-                SamInputResource.of(new SRAAccession(acc))
-        );
-
-        SAMFileHeader header = reader.getFileHeader();
-
-        Chunk chunk;
-        if (refStart != -1) {
-            long refOffset = 0;
-            int refIndex = header.getSequenceDictionary().getSequence(refName).getSequenceIndex();
-            for (SAMSequenceRecord sequenceRecord : header.getSequenceDictionary().getSequences()) {
-                if (sequenceRecord.getSequenceIndex() <  refIndex) {
-                    refOffset += sequenceRecord.getSequenceLength();
-                }
-            }
-
-            chunk = new Chunk(refOffset + refStart - 1, refOffset + refStart);
-        } else {
-            long totalRefLength = header.getSequenceDictionary().getReferenceLength();
-            long totalRecordRange = ((BAMFileSpan)reader.indexing().getFilePointerSpanningReads()).toCoordinateArray()[1];
-            chunk = new Chunk(totalRefLength, totalRecordRange);
-        }
-
-        final SAMRecordIterator samRecordIterator = ((SamReader.Indexing) reader).iterator(new BAMFileSpan(chunk));
-
-        SAMRecord record = null;
-        while (samRecordIterator.hasNext()) {
-            SAMRecord currentRecord = samRecordIterator.next();
-            if (currentRecord.getReadName().equals(readName)) {
-                record = currentRecord;
-                break;
-            }
-        }
-
-        checkSAMRecord(record, flags, readName, bases, quals, refStart, cigar, refName, mapQ, hasMate, isSecondOfPair, isSecondaryAlignment);
-    }
-
-    @Test(dataProvider = "testRows")
-    public void testRowsByIndex(String acc, int recordIndex, int flags, String readName, String bases, String quals,
-                                int refStart, String cigar, String refName, int mapQ, boolean hasMate,
-                                boolean isSecondOfPair, boolean isSecondaryAlignment) {
-        SamReader reader = SamReaderFactory.make().validationStringency(ValidationStringency.SILENT).open(
-                SamInputResource.of(new SRAAccession(acc))
-        );
-
-        Assert.assertTrue(reader.hasIndex());
-        Assert.assertTrue(reader.indexing().hasBrowseableIndex());
-
-        SAMFileHeader header = reader.getFileHeader();
-        BrowseableBAMIndex index = reader.indexing().getBrowseableIndex();
-
-        BAMFileSpan span;
-        if (refStart != -1) {
-            int refIndex = header.getSequenceDictionary().getSequence(refName).getSequenceIndex();
-            span = index.getSpanOverlapping(refIndex, refStart, refStart + 1);
-        } else {
-            long chunkStart = index.getStartOfLastLinearBin();
-            long totalRecordRange = ((BAMFileSpan) reader.indexing().getFilePointerSpanningReads()).toCoordinateArray()[1];
-            span = new BAMFileSpan(new Chunk(chunkStart, totalRecordRange));
-        }
-
-        final SAMRecordIterator samRecordIterator = ((SamReader.Indexing) reader).iterator(span);
-
-        SAMRecord record = null;
-        while (samRecordIterator.hasNext()) {
-            SAMRecord currentRecord = samRecordIterator.next();
-            if (refStart != -1 && currentRecord.getAlignmentStart() + currentRecord.getReadLength() < refStart) {
-                continue;
-            }
-
-            if (currentRecord.getReadName().equals(readName)
-                    && currentRecord.isSecondaryAlignment() == isSecondaryAlignment
-                    && (!hasMate || currentRecord.getSecondOfPairFlag() == isSecondOfPair)) {
-                record = currentRecord;
-                break;
-            }
-        }
-
-        checkSAMRecord(record, flags, readName, bases, quals, refStart, cigar, refName, mapQ, hasMate, isSecondOfPair, isSecondaryAlignment);
-    }
-
-    private SAMRecord getRecordByIndex(String acc, int recordIndex, boolean detach) {
-        SamReader reader = SamReaderFactory.make().validationStringency(ValidationStringency.SILENT).open(
-                SamInputResource.of(new SRAAccession(acc))
-        );
-
-        final SAMRecordIterator samRecordIterator = reader.iterator();
-
-        while (recordIndex != 0) {
-            Assert.assertTrue(samRecordIterator.hasNext(), "Record set is too small");
-
-            samRecordIterator.next();
-            recordIndex--;
-        }
-        Assert.assertTrue(samRecordIterator.hasNext(), "Record set is too small");
-
-        SAMRecord record = samRecordIterator.next();
-
-        if (detach) {
-            samRecordIterator.next();
-        }
-
-        return record;
-    }
-
-    private void checkSAMRecord(SAMRecord record, int flags, String readName, String bases, String quals,
-                                int refStart, String cigar, String refName, int mapQ, boolean hasMate,
-                                boolean isSecondOfPair, boolean isSecondaryAlignment) {
-
-        Assert.assertNotNull(record, "Record with read id: " + readName + " was not found by span created from index");
-
-        List<SAMValidationError> validationErrors = record.isValid();
-        Assert.assertNull(validationErrors, "SRA Lazy record is invalid. List of errors: " +
-                (validationErrors != null ? validationErrors.toString() : ""));
-
-        Assert.assertEquals(record.getReadName(), readName);
-        Assert.assertEquals(new String(record.getReadBases()), bases);
-        Assert.assertEquals(record.getBaseQualityString(), quals);
-        Assert.assertEquals(record.getReadPairedFlag(), hasMate);
-        Assert.assertEquals(record.getFlags(), flags);
-        Assert.assertEquals(record.isSecondaryAlignment(), isSecondaryAlignment);
-        if (hasMate) {
-            Assert.assertEquals(record.getSecondOfPairFlag(), isSecondOfPair);
-        }
-        if (refStart == -1) {
-            Assert.assertEquals(record.getReadUnmappedFlag(), true);
-            Assert.assertEquals(record.getAlignmentStart(), 0);
-            Assert.assertEquals(record.getCigarString(), "*");
-            Assert.assertEquals(record.getReferenceName(), "*");
-            Assert.assertEquals(record.getMappingQuality(), 0);
-        } else {
-            Assert.assertEquals(record.getReadUnmappedFlag(), false);
-            Assert.assertEquals(record.getAlignmentStart(), refStart);
-            Assert.assertEquals(record.getCigarString(), cigar);
-            Assert.assertEquals(record.getReferenceName(), refName);
-            Assert.assertEquals(record.getMappingQuality(), mapQ);
-        }
-    }
 
 }
--- a/src/test/java/htsjdk/tribble/util/ftp/FTPClientTest.java
+++ b/src/test/java/htsjdk/tribble/util/ftp/FTPClientTest.java
@@ -25,225 +25,4 @@
     static byte[] expectedBytes = "abcdefghijklmnopqrstuvwxyz\n".getBytes();
     FTPClient client;
 
-    @BeforeMethod
-    public void setUp() throws IOException {
-        client = new FTPClient();
-        FTPReply reply = client.connect(host);
-        Assert.assertTrue(reply.isSuccess(), "connect");
-    }
-
-    @AfterMethod
-    public void tearDown() {
-        System.out.println("Disconnecting");
-        client.disconnect();
-    }
-
-    @Test
-    public void testLogin() throws Exception {
-
-    }
-
-    @Test
-    public void testPasv() throws Exception {
-        try {
-            FTPReply reply = client.login("anonymous", "igv@broadinstitute.org");
-            Assert.assertTrue(reply.isSuccess(), "login");
-
-            reply = client.pasv();
-            Assert.assertTrue(reply.isSuccess(), "pasv");
-        } finally {
-            client.closeDataStream();
-        }
-    }
-
-    @Test
-    public void testSize() throws Exception {
-
-        FTPReply reply = client.login("anonymous", "igv@broadinstitute.org");
-        Assert.assertTrue(reply.isSuccess());
-
-        reply = client.binary();
-        Assert.assertTrue(reply.isSuccess(), "binary");
-
-        reply = client.size(file);
-        String val = reply.getReplyString();
-        int size = Integer.parseInt(val);
-        Assert.assertEquals(fileSize, size, "size");
-    }
-
-    @Test
-    public void testDownload() throws Exception {
-        try {
-            FTPReply reply = client.login("anonymous", "igv@broadinstitute.org");
-            Assert.assertTrue(reply.isSuccess(), "login");
-
-            reply = client.binary();
-            Assert.assertTrue(reply.isSuccess(), "binary");
-
-            reply = client.pasv();
-            Assert.assertTrue(reply.isSuccess(), "pasv");
-
-            reply = client.retr(file);
-            Assert.assertEquals(reply.getCode(), 150, "retr");
-
-            InputStream is = client.getDataStream();
-            int idx = 0;
-            int b;
-            while ((b = is.read()) >= 0) {
-                Assert.assertEquals(expectedBytes[idx], (byte) b,"reading from stream");
-                idx++;
-            }
-
-        } finally {
-            client.closeDataStream();
-            FTPReply reply = client.retr(file);
-            System.out.println(reply.getCode());
-            Assert.assertTrue(reply.isSuccess(), "close");
-        }
-    }
-
-    @Test
-    public void testRest() throws Exception {
-        try {
-            FTPReply reply = client.login("anonymous", "igv@broadinstitute.org");
-            Assert.assertTrue(reply.isSuccess(), "login");
-
-            reply = client.binary();
-            Assert.assertTrue(reply.isSuccess(), "binary");
-
-            reply = client.pasv();
-            Assert.assertTrue(reply.isSuccess(), "pasv");
-
-            final int restPosition = 5;
-            client.setRestPosition(restPosition);
-
-            reply = client.retr(file);
-            Assert.assertEquals(reply.getCode(), 150, "retr");
-
-            InputStream is = client.getDataStream();
-            int idx = restPosition;
-            int b;
-            while ((b = is.read()) >= 0) {
-                Assert.assertEquals(expectedBytes[idx], (byte) b, "reading from stream");
-                idx++;
-            }
-
-        } finally {
-            client.closeDataStream();
-            FTPReply reply = client.retr(file);
-            System.out.println(reply.getCode());
-            Assert.assertTrue(reply.isSuccess(), "close");
-        }
-    }
-
-    /**
-     * Test accessing a non-existent file
-     */
-    @Test
-    public void testNonExistentFile() throws Exception {
-
-        String host = "ftp.broadinstitute.org";
-        String file = "/pub/igv/TEST/fileDoesntExist.txt";
-        FTPClient client = new FTPClient();
-
-        FTPReply reply = client.connect(host);
-        Assert.assertTrue(reply.isSuccess(), "connect");
-
-        reply = client.login("anonymous", "igv@broadinstitute.org");
-        Assert.assertTrue(reply.isSuccess(), "login");
-
-        reply = client.binary();
-        Assert.assertTrue(reply.isSuccess(), "binary");
-
-        reply = client.executeCommand("size " + file);
-        Assert.assertEquals(550, reply.getCode(), "size");
-
-        client.disconnect();
-    }
-
-    /**
-     * Test accessing a non-existent server
-     */
-    @Test
-    public void testNonExistentServer() throws Exception {
-
-        String host = "ftp.noSuchServer.org";
-        String file = "/pub/igv/TEST/fileDoesntExist.txt";
-        FTPClient client = new FTPClient();
-
-        FTPReply reply = null;
-        try {
-            reply = client.connect(host);
-        } catch (UnknownHostException e) {
-            // This is expected
-        }
-
-        client.disconnect();
-    }
-
-    @Test
-    public void testMultiplePasv() throws Exception {
-
-        try {
-            FTPReply reply = client.login("anonymous", "igv@broadinstitute.org");
-            Assert.assertTrue(reply.isSuccess(), "login");
-
-            reply = client.pasv();
-            Assert.assertTrue(reply.isSuccess(), "pasv 1");
-            client.closeDataStream();
-
-            reply = client.pasv();
-            Assert.assertTrue(reply.isSuccess(), "pasv 2");
-            client.closeDataStream();
-        }
-        finally {
-
-        }
-    }
-
-    @Test
-    public void testMultipleRest() throws Exception {
-        FTPReply reply = client.login("anonymous", "igv@broadinstitute.org");
-        Assert.assertTrue(reply.isSuccess(), "login");
-
-        reply = client.binary();
-        Assert.assertTrue(reply.isSuccess(), "binary");
-
-        restRetr(5, 10);
-        restRetr(2, 10);
-        restRetr(15, 10);
-    }
-
-    private void restRetr(int restPosition, int length) throws IOException {
-
-        try {
-
-            if (client.getDataStream() == null) {
-                FTPReply reply = client.pasv();
-                Assert.assertTrue(reply.isSuccess(), "pasv");
-            }
-
-            client.setRestPosition(restPosition);
-
-            FTPReply reply = client.retr(file);
-            //assertTrue(reply.getCode() == 150);
-
-            InputStream is = client.getDataStream();
-
-            byte[] buffer = new byte[length];
-            is.read(buffer);
-
-            for (int i = 0; i < length; i++) {
-                System.out.print((char) buffer[i]);
-                Assert.assertEquals(expectedBytes[i + restPosition], buffer[i], "reading from stream");
-            }
-            System.out.println();
-        }
-
-        finally {
-            client.closeDataStream();
-            FTPReply reply = client.getReply();  // <== MUST READ THE REPLY
-            System.out.println(reply.getReplyString());
-        }
-    }
 }
--- a/src/test/java/htsjdk/tribble/readers/TabixReaderTest.java
+++ b/src/test/java/htsjdk/tribble/readers/TabixReaderTest.java
@@ -164,29 +164,6 @@
     }
 
     /**
-     * Test reading a tabix file over http
-     *
-     * @throws java.io.IOException
-     */
-    @Test
-    public void testRemoteQuery() throws IOException {
-        String tabixFile = TestUtil.BASE_URL_FOR_HTTP_TESTS +"igvdata/tabix/trioDup.vcf.gz";
-
-        try(TabixReader tabixReader = new TabixReader(tabixFile)) {
-            TabixIteratorLineReader lineReader = new TabixIteratorLineReader(
-                    tabixReader.query(tabixReader.chr2tid("4"), 320, 330));
-    
-            int nRecords = 0;
-            String nextLine;
-            while ((nextLine = lineReader.readLine()) != null) {
-                Assert.assertTrue(nextLine.startsWith("4"));
-                nRecords++;
-            }
-            Assert.assertTrue(nRecords > 0);
-        }
-    }
-    
-    /**
      * Test TabixReader.readLine
      *
      * @throws java.io.IOException
--- a/src/test/java/htsjdk/samtools/cram/ref/EnaRefServiceTest.java
+++ b/src/test/java/htsjdk/samtools/cram/ref/EnaRefServiceTest.java
@@ -14,8 +14,4 @@
                 {"0000088cbcebe818eb431d58c908c698"}};
     }
 
-    @Test(dataProvider = "testEnaRefServiceData")
-    public void testEnaRefServiceData(final String md5) throws GaveUpException {
-        Assert.assertNotNull(new EnaRefService().getSequence(md5));
-    }
 }
--- a/src/test/java/htsjdk/samtools/BAMRemoteFileTest.java
+++ b/src/test/java/htsjdk/samtools/BAMRemoteFileTest.java
@@ -44,276 +44,7 @@
 public class BAMRemoteFileTest extends HtsjdkTest {
     private final File BAM_INDEX_FILE = new File("src/test/resources/htsjdk/samtools/BAMFileIndexTest/index_test.bam.bai");
     private final File BAM_FILE = new File("src/test/resources/htsjdk/samtools/BAMFileIndexTest/index_test.bam");
-    private final String BAM_URL_STRING = TestUtil.BASE_URL_FOR_HTTP_TESTS + "index_test.bam";
-    private final URL bamURL;
 
     private final boolean mVerbose = false;
 
-    public BAMRemoteFileTest() throws Exception {
-        bamURL = new URL(BAM_URL_STRING);
-    }
-
-
-    @Test
-    public void testRemoteLocal() throws Exception {
-        runLocalRemoteTest(bamURL, BAM_FILE, "chrM", 10400, 10600, false);
-    }
-
-    @Test
-    public void testSpecificQueries() throws Exception {
-        assertEquals(runQueryTest(bamURL, "chrM", 10400, 10600, true), 1);
-        assertEquals(runQueryTest(bamURL, "chrM", 10400, 10600, false), 2);
-    }
-
-    @Test
-    public void testRandomQueries() throws Exception {
-        runRandomTest(bamURL, 20, new Random(TestUtil.RANDOM_SEED));
-    }
-
-    @Test
-    public void testWholeChromosomes() {
-        checkChromosome("chrM", 23);
-        checkChromosome("chr1", 885);
-        checkChromosome("chr2", 837);
-        /***
-         checkChromosome("chr3", 683);
-         checkChromosome("chr4", 633);
-         checkChromosome("chr5", 611);
-         checkChromosome("chr6", 585);
-         checkChromosome("chr7", 521);
-         checkChromosome("chr8", 507);
-         checkChromosome("chr9", 388);
-         checkChromosome("chr10", 477);
-         checkChromosome("chr11", 467);
-         checkChromosome("chr12", 459);
-         checkChromosome("chr13", 327);
-         checkChromosome("chr14", 310);
-         checkChromosome("chr15", 280);
-         checkChromosome("chr16", 278);
-         checkChromosome("chr17", 269);
-         checkChromosome("chr18", 265);
-         checkChromosome("chr19", 178);
-         checkChromosome("chr20", 228);
-         checkChromosome("chr21", 123);
-         checkChromosome("chr22", 121);
-         checkChromosome("chrX", 237);
-         checkChromosome("chrY", 29);
-         ***/
-    }
-
-
-    private void checkChromosome(final String name, final int expectedCount) {
-        int count = runQueryTest(bamURL, name, 0, 0, true);
-        assertEquals(count, expectedCount);
-        count = runQueryTest(bamURL, name, 0, 0, false);
-        assertEquals(count, expectedCount);
-    }
-
-    private void runRandomTest(final URL bamFile, final int count, final Random generator) throws IOException {
-        final int maxCoordinate = 10000000;
-        final List<String> referenceNames = getReferenceNames(bamFile);
-        for (int i = 0; i < count; i++) {
-            final String refName = referenceNames.get(generator.nextInt(referenceNames.size()));
-            final int coord1 = generator.nextInt(maxCoordinate + 1);
-            final int coord2 = generator.nextInt(maxCoordinate + 1);
-            final int startPos = Math.min(coord1, coord2);
-            final int endPos = Math.max(coord1, coord2);
-            System.out.println("Testing query " + refName + ":" + startPos + "-" + endPos + " ...");
-            try {
-                runQueryTest(bamFile, refName, startPos, endPos, true);
-                runQueryTest(bamFile, refName, startPos, endPos, false);
-            } catch (Throwable exc) {
-                String message = "Query test failed: " + refName + ":" + startPos + "-" + endPos;
-                message += ": " + exc.getMessage();
-                throw new RuntimeException(message, exc);
-            }
-        }
-    }
-
-    private List<String> getReferenceNames(final URL bamFile) throws IOException {
-
-        final SamReader reader = SamReaderFactory.makeDefault().open(SamInputResource.of(bamFile.openStream()));
-
-        final List<String> result = new ArrayList<String>();
-        final List<SAMSequenceRecord> seqRecords = reader.getFileHeader().getSequenceDictionary().getSequences();
-        for (final SAMSequenceRecord seqRecord : seqRecords) {
-            if (seqRecord.getSequenceName() != null) {
-                result.add(seqRecord.getSequenceName());
-            }
-        }
-        reader.close();
-        return result;
-    }
-
-    private void runLocalRemoteTest(final URL bamURL, final File bamFile, final String sequence, final int startPos, final int endPos, final boolean contained) {
-        verbose("Testing query " + sequence + ":" + startPos + "-" + endPos + " ...");
-        final SamReader reader1 = SamReaderFactory.makeDefault()
-                .disable(SamReaderFactory.Option.EAGERLY_DECODE)
-                .open(SamInputResource.of(bamFile).index(BAM_INDEX_FILE));
-        final SamReader reader2 = SamReaderFactory.makeDefault()
-                .disable(SamReaderFactory.Option.EAGERLY_DECODE)
-                .open(SamInputResource.of(bamURL).index(BAM_INDEX_FILE));
-        final Iterator<SAMRecord> iter1 = reader1.query(sequence, startPos, endPos, contained);
-        final Iterator<SAMRecord> iter2 = reader2.query(sequence, startPos, endPos, contained);
-
-        final List<SAMRecord> records1 = new ArrayList<SAMRecord>();
-        final List<SAMRecord> records2 = new ArrayList<SAMRecord>();
-
-        while (iter1.hasNext()) {
-            records1.add(iter1.next());
-        }
-        while (iter2.hasNext()) {
-            records2.add(iter2.next());
-        }
-
-        assertTrue(records1.size() > 0);
-        assertEquals(records1.size(), records2.size());
-        for (int i = 0; i < records1.size(); i++) {
-            //System.out.println(records1.get(i).format());
-            assertEquals(records1.get(i).getSAMString(), records2.get(i).getSAMString());
-        }
-    }
-
-    private int runQueryTest(final URL bamURL, final String sequence, final int startPos, final int endPos, final boolean contained) {
-        verbose("Testing query " + sequence + ":" + startPos + "-" + endPos + " ...");
-        final SamReader reader1 = SamReaderFactory.makeDefault()
-                .disable(SamReaderFactory.Option.EAGERLY_DECODE)
-                .open(SamInputResource.of(bamURL).index(BAM_INDEX_FILE));
-        final SamReader reader2 = SamReaderFactory.makeDefault()
-                .disable(SamReaderFactory.Option.EAGERLY_DECODE)
-                .open(SamInputResource.of(bamURL).index(BAM_INDEX_FILE));
-        final Iterator<SAMRecord> iter1 = reader1.query(sequence, startPos, endPos, contained);
-        final Iterator<SAMRecord> iter2 = reader2.iterator();
-        // Compare ordered iterators.
-        // Confirm that iter1 is a subset of iter2 that properly filters.
-        SAMRecord record1 = null;
-        SAMRecord record2 = null;
-        int count1 = 0;
-        int count2 = 0;
-        int beforeCount = 0;
-        int afterCount = 0;
-        while (true) {
-            if (record1 == null && iter1.hasNext()) {
-                record1 = iter1.next();
-                count1++;
-            }
-            if (record2 == null && iter2.hasNext()) {
-                record2 = iter2.next();
-                count2++;
-            }
-            if (record1 == null && record2 == null) {
-                break;
-            }
-            if (record1 == null) {
-                checkPassesFilter(false, record2, sequence, startPos, endPos, contained);
-                record2 = null;
-                afterCount++;
-                continue;
-            }
-            assertNotNull(record2);
-            final int ordering = compareCoordinates(record1, record2);
-            if (ordering > 0) {
-                checkPassesFilter(false, record2, sequence, startPos, endPos, contained);
-                record2 = null;
-                beforeCount++;
-                continue;
-            }
-            assertTrue(ordering == 0);
-            checkPassesFilter(true, record1, sequence, startPos, endPos, contained);
-            checkPassesFilter(true, record2, sequence, startPos, endPos, contained);
-            assertEquals(record1.getReadName(), record2.getReadName());
-            assertEquals(record1.getReadString(), record2.getReadString());
-            record1 = null;
-            record2 = null;
-        }
-        CloserUtil.close(reader1);
-        CloserUtil.close(reader2);
-        verbose("Checked " + count1 + " records against " + count2 + " records.");
-        verbose("Found " + (count2 - beforeCount - afterCount) + " records matching.");
-        verbose("Found " + beforeCount + " records before.");
-        verbose("Found " + afterCount + " records after.");
-        return count1;
-    }
-
-    private void checkPassesFilter(final boolean expected, final SAMRecord record, final String sequence, final int startPos, final int endPos, final boolean contained) {
-        final boolean passes = passesFilter(record, sequence, startPos, endPos, contained);
-        if (passes != expected) {
-            System.out.println("Error: Record erroneously " +
-                    (passes ? "passed" : "failed") +
-                    " filter.");
-            System.out.println(" Record: " + record.getSAMString());
-            System.out.println(" Filter: " + sequence + ":" +
-                    startPos + "-" + endPos +
-                    " (" + (contained ? "contained" : "overlapping") + ")");
-            assertEquals(passes, expected);
-        }
-    }
-
-    private boolean passesFilter(final SAMRecord record, final String sequence, final int startPos, final int endPos, final boolean contained) {
-        if (record == null) {
-            return false;
-        }
-        if (!safeEquals(record.getReferenceName(), sequence)) {
-            return false;
-        }
-        final int alignmentStart = record.getAlignmentStart();
-        int alignmentEnd = record.getAlignmentEnd();
-        if (alignmentStart <= 0) {
-            assertTrue(record.getReadUnmappedFlag());
-            return false;
-        }
-        if (alignmentEnd <= 0) {
-            // For indexing-only records, treat as single base alignment.
-            assertTrue(record.getReadUnmappedFlag());
-            alignmentEnd = alignmentStart;
-        }
-        if (contained) {
-            if (startPos != 0 && alignmentStart < startPos) {
-                return false;
-            }
-            if (endPos != 0 && alignmentEnd > endPos) {
-                return false;
-            }
-        } else {
-            if (startPos != 0 && alignmentEnd < startPos) {
-                return false;
-            }
-            if (endPos != 0 && alignmentStart > endPos) {
-                return false;
-            }
-        }
-        return true;
-    }
-
-    private int compareCoordinates(final SAMRecord record1, final SAMRecord record2) {
-        final int seqIndex1 = record1.getReferenceIndex();
-        final int seqIndex2 = record2.getReferenceIndex();
-        if (seqIndex1 == -1) {
-            return ((seqIndex2 == -1) ? 0 : -1);
-        } else if (seqIndex2 == -1) {
-            return 1;
-        }
-        int result = seqIndex1 - seqIndex2;
-        if (result != 0) {
-            return result;
-        }
-        result = record1.getAlignmentStart() - record2.getAlignmentStart();
-        return result;
-    }
-
-    private boolean safeEquals(final Object o1, final Object o2) {
-        if (o1 == o2) {
-            return true;
-        } else if (o1 == null || o2 == null) {
-            return false;
-        } else {
-            return o1.equals(o2);
-        }
-    }
-
-    private void verbose(final String text) {
-        if (mVerbose) {
-            System.out.println("# " + text);
-        }
-    }
 }
--- a/src/test/java/htsjdk/tribble/util/ftp/FTPUtilsTest.java
+++ b/src/test/java/htsjdk/tribble/util/ftp/FTPUtilsTest.java
@@ -15,18 +15,4 @@
 */
 public class FTPUtilsTest extends HtsjdkTest {
 
-    @Test(groups ="ftp")
-    public void testResourceAvailable() throws Exception {
-
-        URL goodUrl = new URL("ftp://ftp.broadinstitute.org/pub/igv/TEST/test.txt");
-        assertTrue(FTPUtils.resourceAvailable(goodUrl));
-
-        URL nonExistentURL = new URL("ftp://ftp.broadinstitute.org/pub/igv/TEST/doesntExist");
-        assertFalse(FTPUtils.resourceAvailable(nonExistentURL));
-
-        URL nonExistentServer = new URL("ftp://noSuchServer/pub/igv/TEST/doesntExist");
-        assertFalse(FTPUtils.resourceAvailable(nonExistentServer));
-
-
-    }
 }
--- a/src/test/java/htsjdk/samtools/seekablestream/SeekableFTPStreamTest.java
+++ b/src/test/java/htsjdk/samtools/seekablestream/SeekableFTPStreamTest.java
@@ -40,67 +40,6 @@
 public class SeekableFTPStreamTest extends HtsjdkTest {
 
 
-    static String urlString = "ftp://ftp.broadinstitute.org/pub/igv/TEST/test.txt";
-    static long fileSize = 27;
-    static byte[] expectedBytes = "abcdefghijklmnopqrstuvwxyz\n".getBytes();
-    SeekableFTPStream stream;
-
-    @BeforeMethod()
-    public void setUp() throws IOException {
-        stream = new SeekableFTPStream(new URL(urlString));
-
-    }
-
-    @AfterMethod()
-    public void tearDown() throws IOException {
-        stream.close();
-    }
-
-    @Test
-    public void testLength() throws Exception {
-        long length = stream.length();
-        Assert.assertEquals(fileSize, length);
-    }
-
-
-    /**
-     * Test a buffered read.  The buffer is much large than the file size,  assert that the desired # of bytes are read
-     *
-     * @throws Exception
-     */
-    @Test
-    public void testBufferedRead() throws Exception {
-
-        byte[] buffer = new byte[64000];
-        int nRead = stream.read(buffer);
-        Assert.assertEquals(fileSize, nRead);
-
-    }
-
-    /**
-     * Test requesting a range that extends beyond the end of the file
-     */
-
-    @Test
-    public void testRange() throws Exception {
-        stream.seek(20);
-        byte[] buffer = new byte[64000];
-        int nRead = stream.read(buffer);
-        Assert.assertEquals(fileSize - 20, nRead);
-
-    }
-
-    /**
-     * Test requesting a range that begins beyond the end of the file
-     */
-
-    @Test
-    public void testBadRange() throws Exception {
-        stream.seek(30);
-        byte[] buffer = new byte[64000];
-        int nRead = stream.read(buffer);
-        Assert.assertEquals(-1, nRead);
-    }
 
 
 }
--- a/src/test/java/htsjdk/tribble/util/ParsingUtilsTest.java
+++ b/src/test/java/htsjdk/tribble/util/ParsingUtilsTest.java
@@ -153,67 +153,12 @@
         tstExists(file.toUri().toString(), false);
     }
 
-    @Test(groups = "ftp")
-    public void testFTPDoesExist() throws IOException{
-        tstExists(AVAILABLE_FTP_URL, true);
-    }
-
-    @Test(groups = "ftp")
-    public void testFTPNotExist() throws IOException{
-        tstExists(UNAVAILABLE_FTP_URL, false);
-    }
-
-    @Test
-    public void testHTTPDoesExist() throws IOException{
-        tstExists(AVAILABLE_HTTP_URL, true);
-    }
-
-    @Test
-    public void testHTTPNotExist() throws IOException{
-        tstExists(UNAVAILABLE_HTTP_URL, false);
-    }
 
     private void tstExists(String path, boolean expectExists) throws IOException{
         boolean exists = ParsingUtils.resourceExists(path);
         Assert.assertEquals(exists, expectExists);
     }
 
-    @Test
-    public void testFileOpenInputStream() throws IOException{
-        File tempFile = File.createTempFile(getClass().getSimpleName(), ".tmp");
-        tempFile.deleteOnExit();
-        OutputStream os = IOUtil.openFileForWriting(tempFile);
-        BufferedWriter writer = new BufferedWriter(new OutputStreamWriter(os));
-        writer.write("hello");
-        writer.close();
-        tstStream(tempFile.getAbsolutePath());
-        tstStream(tempFile.toURI().toString());
-    }
-
-    @Test
-    public void testInMemoryNioFileOpenInputStream() throws IOException{
-        FileSystem fs = Jimfs.newFileSystem(Configuration.unix());
-        Path file = fs.getPath("/file");
-        Files.write(file, "hello".getBytes("UTF-8"));
-        tstStream(file.toUri().toString());
-    }
-
-    @Test(groups = "ftp")
-    public void testFTPOpenInputStream() throws IOException{
-        tstStream(AVAILABLE_FTP_URL);
-    }
-
-    @Test
-    public void testHTTPOpenInputStream() throws IOException{
-        tstStream(AVAILABLE_HTTP_URL);
-    }
-
-    private void tstStream(String path) throws IOException{
-        InputStream is = ParsingUtils.openInputStream(path);
-        Assert.assertNotNull(is, "InputStream is null for " + path);
-        int b = is.read();
-        Assert.assertNotSame(b, -1);
-    }
 
 
 }
--- a/src/test/java/htsjdk/tribble/AbstractFeatureReaderTest.java
+++ b/src/test/java/htsjdk/tribble/AbstractFeatureReaderTest.java
@@ -50,54 +50,6 @@
     //wrapper which skips the first byte of a file and leaves the rest unchanged
     private static final Function<SeekableByteChannel, SeekableByteChannel> WRAPPER = SkippingByteChannel::new;
 
-    /**
-     * Asserts readability and correctness of VCF over HTTP.  The VCF is indexed and requires and index.
-     */
-    @Test
-    public void testVcfOverHTTP() throws IOException {
-        final VCFCodec codec = new VCFCodec();
-        final AbstractFeatureReader<VariantContext, LineIterator> featureReaderHttp =
-                AbstractFeatureReader.getFeatureReader(HTTP_INDEXED_VCF_PATH, codec, true); // Require an index to
-        final AbstractFeatureReader<VariantContext, LineIterator> featureReaderLocal =
-                AbstractFeatureReader.getFeatureReader(LOCAL_MIRROR_HTTP_INDEXED_VCF_PATH, codec, false);
-        final CloseableTribbleIterator<VariantContext> localIterator = featureReaderLocal.iterator();
-        for (final Feature feat : featureReaderHttp.iterator()) {
-            assertEquals(feat.toString(), localIterator.next().toString());
-        }
-        assertFalse(localIterator.hasNext());
-    }
-
-    @Test(groups = "ftp")
-    public void testLoadBEDFTP() throws Exception {
-        final String path = "ftp://ftp.broadinstitute.org/distribution/igv/TEST/cpgIslands with spaces.hg18.bed";
-        final BEDCodec codec = new BEDCodec();
-        final AbstractFeatureReader<BEDFeature, LineIterator> bfs = AbstractFeatureReader.getFeatureReader(path, codec, false);
-        for (final Feature feat : bfs.iterator()) {
-            assertNotNull(feat);
-        }
-    }
-
-    @Test(dataProvider = "blockCompressedExtensionExtensionStrings", dataProviderClass = IOUtilTest.class)
-    public void testBlockCompressionExtensionString(final String testString, final boolean expected) {
-        Assert.assertEquals(AbstractFeatureReader.hasBlockCompressedExtension(testString), expected);
-    }
-
-    @Test(dataProvider = "blockCompressedExtensionExtensionStrings", dataProviderClass = IOUtilTest.class)
-    public void testBlockCompressionExtensionFile(final String testString, final boolean expected) {
-        Assert.assertEquals(AbstractFeatureReader.hasBlockCompressedExtension(new File(testString)), expected);
-    }
-
-    @Test(dataProvider = "blockCompressedExtensionExtensionURIStrings", dataProviderClass = IOUtilTest.class)
-    public void testBlockCompressionExtension(final String testURIString, final boolean expected) {
-        URI testURI = URI.create(testURIString);
-        Assert.assertEquals(AbstractFeatureReader.hasBlockCompressedExtension(testURI), expected);
-    }
-
-    @Test(dataProvider = "blockCompressedExtensionExtensionURIStrings", dataProviderClass = IOUtilTest.class)
-    public void testBlockCompressionExtensionStringVersion(final String testURIString, final boolean expected) {
-        Assert.assertEquals(AbstractFeatureReader.hasBlockCompressedExtension(testURIString), expected);
-    }
-
 
     @DataProvider(name = "vcfFileAndWrapperCombinations")
     private static Object[][] vcfFileAndWrapperCombinations(){
--- a/src/test/java/htsjdk/variant/PrintVariantsExampleTest.java
+++ b/src/test/java/htsjdk/variant/PrintVariantsExampleTest.java
@@ -50,10 +50,12 @@
                 tempFile.getAbsolutePath()
         };
         Assert.assertEquals(tempFile.length(), 0);
+        /*
         PrintVariantsExample.main(args);
         Assert.assertNotEquals(tempFile.length(), 0);
 
         assertFilesEqualSkipHeaders(tempFile, f1);
+        */
     }
 
     private void assertFilesEqualSkipHeaders(File tempFile, File f1) throws FileNotFoundException {
--- a/src/test/java/htsjdk/samtools/util/HttpUtilsTest.java
+++ /dev/null
@@ -1,34 +0,0 @@
-package htsjdk.samtools.util;
-import java.io.IOException;
-import java.net.URL;
-
-import org.testng.Assert;
-import org.testng.annotations.DataProvider;
-import org.testng.annotations.Test;
-
-import htsjdk.HtsjdkTest;
-
-@Test(groups = "http")
-public class HttpUtilsTest extends HtsjdkTest {
-    @DataProvider(name = "existing_urls")
-    public Object[][] testExistingURLsData() {
-        return new Object[][]{
-            {"http://broadinstitute.github.io/picard/testdata/index_test.bam"},
-            {"http://ftp.1000genomes.ebi.ac.uk/vol1/ftp/README_using_1000genomes_cram.md"}
-        };
-    }
-
-    @Test(dataProvider="existing_urls")
-    public void testGetHeaderField(final String url) throws IOException {
-        final String field = HttpUtils.getHeaderField(new URL(url), "Content-Length");
-        Assert.assertNotNull(field);
-        final long length = Long.parseLong(field);
-        Assert.assertTrue(length > 0L);
-    }
-
-    @Test(dataProvider="existing_urls")
-    public void testGetETag(final String url) throws IOException {
-        final String field = HttpUtils.getETag(new URL(url));
-        Assert.assertNotNull(field);
-    }
-}
--- a/src/test/java/htsjdk/samtools/HtsgetBAMFileReaderTest.java
+++ b/src/test/java/htsjdk/samtools/HtsgetBAMFileReaderTest.java
@@ -30,7 +30,7 @@
     private static HtsgetBAMFileReader bamFileReaderHtsgetPOST;
     private static HtsgetBAMFileReader bamFileReaderHtsgetAsync;
 
-    @BeforeTest
+    //@BeforeTest
     public void init() throws IOException {
         bamFileReaderHtsgetGET = new HtsgetBAMFileReader(htsgetBAM, true, ValidationStringency.DEFAULT_STRINGENCY, DefaultSAMRecordFactory.getInstance(), false);
         bamFileReaderHtsgetGET.setUsingPOST(false);
@@ -45,7 +45,7 @@
         Assert.assertFalse(bamFileReaderHtsgetAsync.isUsingPOST());
     }
 
-    @AfterTest
+    //@AfterTest
     public void tearDown() {
         bamFileReaderHtsgetGET.close();
         bamFileReaderHtsgetPOST.close();
@@ -61,14 +61,14 @@
         };
     }
 
-    @Test(dataProvider = "readerProvider")
+    @Test(dataProvider = "readerProvider", enabled=false)
     public static void testGetHeader(final HtsgetBAMFileReader htsgetReader) {
         final SAMFileHeader expectedHeader = SamReaderFactory.makeDefault().open(bamFile).getFileHeader();
         final SAMFileHeader actualHeader = htsgetReader.getFileHeader();
         Assert.assertEquals(actualHeader, expectedHeader);
     }
 
-    @Test(dataProvider = "readerProvider")
+    @Test(dataProvider = "readerProvider", enabled=false)
     public static void testQueryMapped(final HtsgetBAMFileReader htsgetReader) throws IOException {
         try (final SamReader samReader = SamReaderFactory.makeDefault().open(bamFile);
              final SAMRecordIterator samRecordIterator = samReader.iterator()) {
@@ -103,7 +103,7 @@
         }
     }
 
-    @Test(dataProvider = "readerProvider")
+    @Test(dataProvider = "readerProvider", enabled=false)
     public static void testQueryUnmapped(final HtsgetBAMFileReader htsgetReader) throws IOException {
         int counter = 0;
         try (final SamReader fileReader = SamReaderFactory.makeDefault().open(bamFile);
@@ -125,7 +125,7 @@
         }
     }
 
-    @Test(dataProvider = "readerProvider")
+    @Test(dataProvider = "readerProvider", enabled=false)
     public static void testQueryInterval(final HtsgetBAMFileReader htsgetReader) throws IOException {
         final QueryInterval[] query = new QueryInterval[]{new QueryInterval(0, 1519, 1520), new QueryInterval(1, 470535, 470536)};
         try (final SamReader fileReader = SamReaderFactory.makeDefault().open(bamFile);
@@ -146,7 +146,7 @@
         }
     }
 
-    @Test(dataProvider = "readerProvider")
+    @Test(dataProvider = "readerProvider", enabled=false)
     public static void testQueryContained(final HtsgetBAMFileReader htsgetReader) throws IOException {
         int counter = 0;
         try (final SamReader fileReader = SamReaderFactory.makeDefault().open(bamFile);
@@ -187,7 +187,7 @@
         }
     }
 
-    @Test(dataProvider = "readerProvider")
+    @Test(dataProvider = "readerProvider", enabled=false)
     public static void testQueryOverlapped(final HtsgetBAMFileReader htsgetReader) throws IOException {
         int counter = 0;
         try (final SamReader fileReader = SamReaderFactory.makeDefault().open(bamFile);
@@ -209,7 +209,7 @@
         }
     }
 
-    @Test(dataProvider = "readerProvider")
+    @Test(dataProvider = "readerProvider", enabled=false)
     public static void testRemovesDuplicates(final HtsgetBAMFileReader htsgetReader) throws IOException {
         // TODO: temporary workaround as reference server does not properly merge regions and remove duplicates yet
         // See https://github.com/ga4gh/htsget-refserver/issues/27
@@ -242,7 +242,7 @@
         }
     }
 
-    @Test(dataProvider = "readerProvider")
+    @Test(dataProvider = "readerProvider", enabled=false)
     public static void testQueryAlignmentStartNone(final HtsgetBAMFileReader htsgetReader) throws IOException {
         // the first read starts from 1519
         try (final SamReader fileReader = SamReaderFactory.makeDefault().open(bamFile);
@@ -253,7 +253,7 @@
         }
     }
 
-    @Test(dataProvider = "readerProvider")
+    @Test(dataProvider = "readerProvider", enabled=false)
     public static void testQueryAlignmentStartOne(final HtsgetBAMFileReader htsgetReader) throws IOException {
         // one read on chrM starts from 9060
         try (final SamReader fileReader = SamReaderFactory.makeDefault().open(bamFile);
@@ -272,7 +272,7 @@
         }
     }
 
-    @Test
+    @Test(enabled=false)
     public static void testEnableFileSource() {
         final SamReader reader = SamReaderFactory.makeDefault().open(new SamInputResource(new FileInputResource(bamFile)));
         bamFileReaderHtsgetGET.enableFileSource(reader, true);
--- a/src/test/java/htsjdk/beta/codecs/reads/htsget/HtsgetBAM/HtsgetBAMCodecTest.java
+++ b/src/test/java/htsjdk/beta/codecs/reads/htsget/HtsgetBAM/HtsgetBAMCodecTest.java
@@ -41,7 +41,7 @@
         HtsDefaultRegistry.getReadsResolver().getReadsEncoder(htsgetBAM, new ReadsEncoderOptions());
     }
 
-    @Test
+    @Test(enabled=false)
     public void testGetHeader() {
         try (final ReadsDecoder htsgetDecoder =
                 HtsDefaultRegistry.getReadsResolver().getReadsDecoder(htsgetBAM, new ReadsDecoderOptions())) {
@@ -51,7 +51,7 @@
         }
     }
 
-    @Test
+    @Test(enabled=false)
     public void testIteration() {
         try (final ReadsDecoder htsgetDecoder =
                      HtsDefaultRegistry.getReadsResolver().getReadsDecoder(htsgetBAM, new ReadsDecoderOptions())) {
@@ -67,7 +67,7 @@
         }
     }
 
-    @Test
+    @Test(enabled=false)
     public void testQueryInterval() throws IOException {
         try (final ReadsDecoder htsgetDecoder =
                      HtsDefaultRegistry.getReadsResolver().getReadsDecoder(htsgetBAM, new ReadsDecoderOptions())) {
@@ -95,7 +95,7 @@
         }
     }
 
-    @Test
+    @Test(enabled=false)
     public void testQueryUnmapped() {
         try (final ReadsDecoder htsgetDecoder =
                      HtsDefaultRegistry.getReadsResolver().getReadsDecoder(htsgetBAM, new ReadsDecoderOptions())) {
@@ -112,7 +112,7 @@
         }
     }
 
-    @Test(expectedExceptions = HtsjdkUnsupportedOperationException.class)
+    @Test(expectedExceptions = HtsjdkUnsupportedOperationException.class, enabled=false)
     public void testRejectQueryMate() {
         SAMRecord samRec = null;
         try (final ReadsDecoder htsgetDecoder =
